CADERNO DE CIÊNCIAS AGRÁRIAS
Agrarian Sciences Journal
Caracterização genotípica de Staphylococcus aureus resistentes à meticilina isolados de
tetos e leite bovino
Laura Francielle Ferreira Borges
1
*; Cintya Neves de Souza
2
; Ester Dias Xavier
3
; Edmara Andrade Macedo
Cruz
4
; Alessandra Rejane Ericsson de Oliveira Xavier
5
; Demerson Arruda Sanglard
6
; Geziella Aurea Aparecida
Damasceno Souza
7
; Carolina Magalhães Caires Carvalho
8
DOI: https://doi.org/10.35699/2447-6218.2020.25185
Resumo:
O presente estudo teve como objetivo verificar a presença dos genes mecA, mecA
LGA251
, blaZ em isolados de S. aureus
resistente a antibióticos beta-lactâmicos, provenientes de amostras de vacas diagnosticadas com mastite subclínica de
rebanhos do norte de Minas Gerais. Isolados previamente identificados através da detecção do gene femA e MALDI-TOF
MS e resistentes a antibióticos do grupo beta-lactâmicos foram utilizados. Os isolados foram submetidos à extração de
DNA e para o rastreamento dos genes de resistência utilizou se a técnica de PCR. Embora fenotipicamente resistente
a oxacilina e cefoxitina nenhuma das linhagens apresentou resultado positivo para os genes mecA e mecA
LGA251
nos
ensaios efetuados, a ausência destes não descarta a possibilidade da presença de outros genes de resistências nas
propriedades rurais em estudo. Porém, a presença do gene blaZ foi verificada em 4 (12,90%) dos isolados em estudo.
Os resultados destacam a necessidade do monitoramento e adoção de medidas de controle que evitem à disseminação
desses genes que representam grande risco a saúde pública.
Palavras chaves: Genes bacterianos. Mastite bovina. Saúde pública.
Genotypic characterization of methicillin-resistant Staphylococcus aureus isolated from
teats and bovine milk
Abstract: The present study aimed to verify the presence of the mecA and mecA
LGA251
genes and blaZ in isolates of S.
aureus previously identified and resistant to beta-lactams antibiotics, from samples of cows diagnosed with subcli-
nical mastitis on the surface of bovine ceilings herds in north of Minas Gerais. Isolates previously identified through
the detection of the femA gene and MALDI-TOF MS and resistant to antibiotics of the beta-lactams group were used.
The isolates were subjected to DNA extraction and the screening of resistance genes was performed using the PCR
technique. Although phenotypically resistant to oxacillin and cefoxitin, none of the strains showed positive results for
1Universidade Federal de Minas Gerais, Instituto de Ciências Agrárias. Montes Claros, MG. Brasil.
https://orcid.org/0000-0002-1854-7077
2
Universidade Federal de Minas Gerais, Instituto de Ciências Agrárias. Montes Claros, MG. Brasil.
https://orcid.org/0000-0002-3640-8636
3
Universidade Federal de Minas Gerais, Instituto de Ciências Agrárias. Montes Claros, MG. Brasil.
https://orcid.org/0000-0001-8289-3540
4
Universidade Federal de Minas Gerais, Instituto de Ciências Agrárias. Montes Claros, MG. Brasil.
https://orcid.org/0000-0002-2493-978X
5
Universidade Estadual de Montes Claros. Montes Claros, MG. Brasil.
https://orcid.org/0000-0001-8558-4196
6
Universidade Federal de Minas Gerais, Instituto de Ciências Agrárias. Montes Claros, MG. Brasil.
https://orcid.org/0000-0001-6759-9730
7
Universidade Estadual de Montes Claros. Montes Claros, MG. Brasil
https://orcid.org/0000-0002-7130-3776
8
Universidade Federal de Minas Gerais, Instituto de Ciências Agrárias. Montes Claros, MG. Brasil.
https://orcid.org/0000-0002-3145-0253
*Autor para correspondência: lauraborges4@outlook.com
Recebido para publicação em 05 de setembro de 2020. Aceito para publicação em 23 de novembro de 2020.
e-ISSN: 2447-6218 / ISSN: 2447-6218 / © 2009, Universidade Federal de Minas Gerais, Todos os direitos reservados.
Borges, L. F. F. et al.
2
Cad. Ciênc. Agrá., v. 12, p. 01–07, https://doi.org/10.35699/2447-6218.2020.25185
the mecA and mecA
LGA251
genes in the tests performed, their absence does not rule out the possibility of the presence
of other resistance genes in the rural properties under study. However, the presence of the blaZ gene was verified in 4
(12.90%) of the isolates under study. The results highlight the need for monitoring and adoption of control measures
that prevent the spread of these genes that represent a great risk to public health.
Keywords: Bacterial genes. Bovine mastitis. Public health.
Introdução
A mastite bovina é uma patologia predominante
na pecuária leiteira, caracterizada pela inflamação das
glândulas mamárias, responsável por grandes perdas
econômicas, pela redução da qualidade e produção do
leite. (Silva et al., 2013). Um método eficaz e de baixo
custo para o controle e prevenção da mastite é o uso de
boas práticas durante a ordenha, entretanto, na conduta
terapêutica é importante a identificação do patógeno e o
monitoramento da resistência aos antimicrobianos nos
casos de mastite subclínica (Moritz; Moritz 2016).
O uso inadequado e indiscriminado de antimicro-
bianos tem promovido a ocorrência de cepas resistentes,
prejudicando a eficiência do tratamento, tornando-se um
problema de saúde humana e animal (Mendonça et al.,
2012); Moritz; Moritz (2016). Diversos microrganismos
patogênicos podem causar inflamação no teto do animal,
entretanto Staphylococcus aureus (S. aureus) é um dos
principais agentes etiológicos causadores da mastite bo-
vina (Silva et al., 2013; Song et al., 2016; Sheet et al.,
2019).
A meticilina é um antimicrobiano do grupo be-
ta-lactâmico que normalmente não é utilizado no trata-
mento da mastite, porém, cepas de S. aureus meticilina
resistentes (MRSA) têm sido identificadas em fazendas
leiteiras (Paterson et al. 2014), tornando-se preocupante
em termos de saúde pública, já que são frequentemente
identificadas como causadoras de infecções hospitalares,
até mesmo nas unidades de terapia intensiva (Rabelo et
al., 2014; Cerqueira; Almeida, 2013).
Estudos relatam o isolamento de estafilococos
multirresistentes à meticilina em animais, humanos (Si-
queira et al., 2017) e em alimentos de origem animal,
como carne bovina e suína, frango, leite e outros deriva-
dos (Cerqueira; Almeida, 2013). Além disso, o consumo
de leite e derivados contaminados pode desencadear a
transferência de MRSA para seres humanos (Silva et al.,
2018).
O isolamento de MRSA em amostras de leite é
realizado através de provas fenotípicas pelo plaquea-
mento em meios de cultura seletivos como ágar base
acrescido de sangue ovino, ágar MRSA e pelo ágar sal
manitol (Silva et al., 2018). A identificação fenotípica de
resistência a meticilina pode ser realizada por meio de
testes de suscetibilidade aos antimicrobianos oxacilina e
cefoxitina (CLSI, 2018). A nível molecular a resistência
a meticilina pode ser detectada através da técnica de
Reação em Cadeira de Polimerase (PCR) por meio da
amplificação dos genes mecA e mecC (Silva et al., 2018),
recentemente foi detectado um homólogo do mecA, o
mecA
LGA251
(García-Álvarez et al., 2011).
A resistência estafilocócica aos antibióticos be-
ta-lactâmicos é resultante de dois mecanismos distintos:
produção da enzima extracelular beta-lactamase, codifi-
cada pelo gene blaZ ou pela produção de PBP2a ou PBP2,
uma proteína ligante de penicilina de baixa afinidade,
codificada pelo gene mecA e seu homólogomecA
LGA251
(García-Álvarez et al., 2011; Mendonça, et al., 2012).
O aumento nas taxas de ocorrências, as mu-
danças no padrão epidemiológico das cepas MRSA e as
dificuldades no tratamento das infecções ocasionadas
por essa bactéria têm colocado a mesma em destaque
dentre os microrganismos de notoriedade médica e de
desafio á saúde pública mundial (Sales; Mendes, 2012).
Visto que linhagens de MRSA produzem diversas toxinas
associadas à intoxicação alimentar em humanos (Siquei-
ra et al., 2017), assim é indispensável à realização de
novos estudos para compreender a transmissão entre as
espécies e o perigo que cada uma impõem em relação
à saúde pública, principalmente estudos de distribuição
molecular dos isolados (Pantosti, 2012).
Considerando este cenário, o presente estudo
teve como objetivo detectar a presença dos genes mecA,
mecA
LGA251
e blaZ por meio da reação em cadeia da po-
limerase (PCR), a partir de DNA genômico extraído de
cepas de Staphylococcus aureus provenientes de amostras
de leite mastítico de diferentes propriedades do norte de
Minas Gerais.
Materiais e métodos
Aprovação ética
Este trabalho foi realizado dentro dos princípios
éticos aprovados pela Comissão de Ética e Experimen-
tação Animal da Universidade Federal de Minas Gerais
(UFMG) sob o protocolo número 145 de 2013.
Isolados bacterianos e perfil de sensibilidade a anti-
microbianos beta-lactâmicos
Caracterização genotípica de Staphylococcus aureus resistentes à meticilina isolados de tetos e leite bovino
3
Cad. Ciênc. Agrá., v. 12, p. 01–07, https://doi.org/10.35699/2447-6218.2020.25185
Trinta e um isolados de S. aureus da bacterioteca
do laboratório de Sanidade Animal do Instituto de Ciên-
cias Agrárias da Universidade Federal de Minas Gerais,
registrados no Sistema Nacional de Gestão do Patrimônio
Genético e do Conhecimento Associado (SisGen), cadastro
AD13F8D, foram utilizados neste estudo. As amostras de
S. aureus foram isoladas em nove propriedades rurais
do norte de Minas Gerais, sendo estes isolados 27 do
leite de vacas diagnosticadas com mastite subclínica e
4 da superfície de teto bovino. A coleta do leite nessas
propriedades foi realizada em julho de 2018, e janeiro
a abril de 2016 e julho de 2019.
Os isolados foram previamente identificados por
meio da detecção do gene femA, marcador especifico de
espécie para S. aureus meticilina resistente, conforme
descrito por (Xavier et al., 2017a) e MALDI-TOF MS
(Assis et al., 2017) e testados quanto ao perfil de sen-
sibilidade a antibióticos do grupo beta-lactâmicos pelo
método disco de difusão conforme protocolo do Clinical
and Laboratory Standards Institute (CLSI, 2018). Foram
testados os antimicrobianos oxacilina (1µg), cefoxitina
(30µg), penicilina (10 µg), amoxicilina (10µg), cefoxitina
(30µg) e ampicilina (10µg) da Laborclin. Como controle
positivo foi utilizado uma cepa padrão de S. aureus ATCC
25923.
Extração DNA e PCR do gene 16S rDNA
Os isolados criopreservados foram reativados em
caldo BHI (Kasvi) e incubados a 37°C por 24 horas. O
DNA genômico foi extraído pelo método de digestão por
proteinase K, seguidas por fenol-clorofórmio de acordo
com metodologia descrita por Gu et al. (2005). A inte-
gridade do DNA foi verificada por eletroforese em gel
de agarose 1,2%. O material obtido foi empregue nas
reações de PCR neste estudo.
A amplificação do gene 16S rDNA universal
bacteriano foi verificado por PCR, utilizando os primers
DG74 5’AGGAGGTGATCCAACCGCA3’ e RW01 5’AAC-
TGGAGGAAGGTGGGGAT3’, segundo metodologia des-
crita por Xavier et al. (2017b). As reações foram efe
-
tuadas em um mix contendo 2X GoTaq
®
Green Master
Mix(Promega Corporation, EUA), MgCl2 (2,5 mm), 10
µM de cada primer e 50 ng de DNA bacteriano, totali-
zando um volume final de reação de 50µL. As condições
de amplificação foram as seguintes: um ciclo inicial de
desnaturação a 94°C por 5 minutos, seguido de 35 ciclos
de desnaturação a 95°C por 30 s, recozimento a 57°C por
30s, extensão a 72°C por 45 se uma extensão final de 10
min.Os amplicons foram visualizados em gel de agarose
a 1,5% corados com gel red e fotodocumentados.
Os primers utilizados neste estudo foram sinte-
tizados pela Integrad DNA Technology, EUA.
Análise PCR para a detecção dos genes mecA, mecA
LGA251
e blaZ
A técnica de PCR também foi utilizada para de-
terminação da presença dos genes mecA, mecA
LGA251A
e
blaZ.
Trinta e um isolados foram utilizados no rastrea-
mento dos genes mecA e mecA
LGA251
e blaZ. Os iniciadores,
programas de amplificação e os tamanhos dos fragmentos
esperados na amplificação pela reação estão descritos
na Tabela 1. As reações foram realizadas em um mix
contendo 1x Tampão da Taq do kit Kappa PCR, 3,5 µL de
MgCl
2
(2,5mm), 2,5 µL de Tris, deoxinucleotídeos (1µM),
0,1 µl de Taq Polimerase (Kappa0,5U), 1,0 µL de cada
primer e 3 µL (50ng/µL) de DNA bacteriano, com um
volume final de reação de 25 µL.As reações foram reali-
zadas em Thermal Cycler T100™ (Bio RadLaboratories,
Alemanha). As condições para realização da PCR foram
descritas de acordo com os autores citados na Tabela 1.
Os amplicons foram visualizados em gel de agarose a
1,5% corados com Gel Red e fotodocumentados. Como
controle positivo, utilizou-se a cepa padrão S. aureus
ATCC 43300.
Tabela 1Primers e condições de amplificação para a detecção dos genes mecA, mecA
LGA251
, blaZ em isolados de S.
aureus de amostras de leite bovino diagnosticados com mastite subclínica.
Primer Sequência Gene Amplicon Referência
MECA1
MECA2
AGTTCTGCAGTACCGGATTTGC
AAATCGATGGTAAAGGTTGGC
mecA
533 pb
Dias et al.,(2011).
MECAL1
MECAL2
TCACCAGGTTCAAC[Y]CAAAA
CCTGAATC[W]GCTAATAATATTTC
mecA
LGA251
344 pb
García-Álvarez et
al., (2011).
BLAZ1
BLAZ2
TTAAAGTCTTACCGAAAGCAG
TAAGAGATTTGCCTATGCTT
blaZ
377 pb
Bagcigil et al.,
(2012),
Olsen et al.,
(2006);
Borges, L. F. F. et al.
4
Cad. Ciênc. Agrá., v. 12, p. 01–07, https://doi.org/10.35699/2447-6218.2020.25185
Resultados e Discussão
A partir da PCR da região 16S rDNA ribossomal
de bactérias, observou-se a amplificação de um fragmento
de aproximadamente 370pb, compatível com a região
analisada, em todos os isolados utilizados no estudo.
Embora fenotipicamente tenha sido observado
que as cepas utilizadas foram resistentes a oxacilina e
cefoxitina, a presença dos genes mecA (Figura 1) com
fragmento de 533 pb e mecA
LGA251
344 pb não foram
verificados nas análises efetuadas. A cepa ATCC 43300
de S. aureus utilizada como controle positivo amplificou
para ambos os genes nos ensaios realizados.
Figura 1 – Detecção do gene mecA por PCR em S. aureus isolados de leite mastítico e da superfície do teto de vacas em
propriedades rurais no norte de Minas Gerais
M: Marcador de massa molecular DNA de 100 pares de base (Cellco); Linhas 1 a 10: Isolados leite de vacas diagnosticadas com mastite subclínica.
Linhas 11 a 14: Isolados da pele de vacas leiteiras. Linhas 15 a 19:Isolados leite de vacas com mastite subclínica. A linha 20 representa o controle
positivo: cepa S. aureus ATCC 43300.Gel de agarose a 1,5%.
Este estudo não identificou a presença dos ge-
nes mecA e mecA
LGA251
, estes resultados são compatíveis
com os descritos por Mendonça et al. (2012), que não
observaram a presença do gene mecA em 250 cepas de
Staphylococcussp isolados de tetos com mastite subclínica
no Brasil , resistentes a meticilina. Os autores relatam
que não tem sido observada correlação entre os perfis
fenotípicos de resistência e a detecção gênica, sendo ne-
cessário investigar os processos de regulagem e transcrição
gênica do mecA, bem como do produto dessa expressão,
PBP2a e PBP2b proteínas ligantes de penicilina de baixa
afinidade, responsáveis pela resistência antimicrobiana.
Sheet et al. (2019), também não observaram
a presença do gene mecA em isolados do leite de vacas
diagnosticas com mastite na Alemanha,estes isolados
foram classificados como S. aureus suscetível à meticilina
(MSSA). Melo et al., 2014, relatam S. aureus isolados de
leite e Staphylococcus coagulase negativo das mãos de
ordenhadores fenotipicamente resistentes a oxacilina e
negativos para o gene mecA no Rio de Janeiro .Resultados
divergentes observados em leite de tetos com masite são
descritos na literatura, Diniz et al.(2010), encontraram o
gene mecA em 33,78% dos isolados resistentes a oxaci-
lina, sendo mais frequentemente isolado em S. aureus e
Staphylococcus coagulase negativa, com índices de 48%
e 32% respectivamente, em isolados de mastite recorren-
te em propriedades rurais da região de Uberlândia em
Minas Gerais. Qu et al. (2019) verificaram presença de
mecA 16% e gene blaZ em 95% de isolados de S. aureus
proveniente de vacas com mastite clínica em fazendas
leiteiras em diferentes regiões da China. Dias et al. (2011),
avaliaram 200 amostras de leite obtidas de tanques de
refrigeração em propriedades rurais da microrregião de
Sete Lagoas em Minas Gerais, observando que 11% das
amostras apresentavam o gene mecA.
Os resultados obtidos para o gene mecA
LGA251
são semelhantes ao resultado de Souza et al. (2019),
que avaliaram a resistência fenotípica e genotípica em
S. aureus isolados de leite de bovino em fazendas na
região norte de Minas Gerais, os autores relatam que os
isolados apresentarem resistência fenotípica a pelo menos
três antibióticos beta-lactâmicos, mas não identificaram
resultado positivo para mecA
LGA251
. No Brasil, nenhum
estudo detectou a presença do gene mecA
LGA251
, corro-
borando com os resultados obtidos. Diaz et al. (2016)
publicaram estudo de metanálise indicando uma baixa
prevalência (0,009%) deste gene entre os MRSA, des-
tacando a importância de monitorar a epidemiologia
dessa forma variante emergente.O uso generalizado de
antibióticos em medicina humana, veterinária e agri-
cultura tem desempenhado papel significativo no surgi-
mento de clones resistentes de MRSA devido à pressão
de seleção (Mehndiratta; Bhalla, 2014), agravando este
sério problema de saúde pública mundial. O Grupo de
Trabalho Internacional sobre Classificação de Elementos
Cromossômicos de Cassetes Estafilocócicos (IWG-SCC)
(2009) relatam que determinar o mecanismo SCC não é
indicado como o único foco na detecção da resistência á
meticilina, uma vez que foram descritos outros elementos
que não apresentam o gene mecA, mas contêm outros
genes que codificam fatores de virulência ou resistência
a outros antimicrobiano.
Caracterização genotípica de Staphylococcus aureus resistentes à meticilina isolados de tetos e leite bovino
5
Cad. Ciênc. Agrá., v. 12, p. 01–07, https://doi.org/10.35699/2447-6218.2020.25185
O gene blaZ foi observado em 4 (12,90%) dos
isolados resistentes a beta-lactâmicos avaliados e na
cepa padrão de S. aureus ATCC 43300, apresentando um
produto de amplificação com tamanho correspondente
a 377 pb conforme demonstrado na figura 2.
Figura 2 – PCR para identificação do gene blaZ sobre as amostras de Staphylococcus aureus isoladas de leite mastítico
em propriedades no norte de Minas Gerais.
M: Marcador de massa molecular DNA de 100 pares de base (Cellco). A linha 1representa o controle positivo S. aureus ATCC 43300. Linhas 2 a 14:
S. aureus provenientes do leitede vacas diagnosticadas com mastite subclínica Gel de agarose a 1,5%.
A baixa porcentagem de S. aureus positivos para o
gene blaZ neste estudo indica que pode haver a presença
de outros genes responsáveis pela resistência bacteriana
aos antibióticos beta-lactâmicos. Rahi et al. (2020) ava-
liaram 28 isolados provenientes de amostras de leite cru,
incluindo bovinos, ovinos, caprinos, búfalos e camelos
de diferentes centros comerciais, os autores encontram
uma maior ocorrência do gene blaZ, onde 100% dos
isolados apresentavam o gene. Para Silva et al. (2018), a
transmissão de S. aureus meticilina resistente (MRSA) por
meio do contato de humano com animais ou vice-versa,
possibilita a transmissão desse patógeno entre espécies,
contribuindo com a variação nas taxas de infecções.
Os resultados obtidos são semelhantes ao de
Bissong e Ateba (2020), que identificaram o gene blaZ
em 37,7% dos isolados de amostras de leite pasteurizado
e não pasteurizado no noroeste da província da África
do Sul. De acordo com Schnitt e Tenhagen (2019), o
risco de infecção por MRSA através do consumo de leite
aparenta ser baixo, pois geralmente o leite é submetido
a tratamento térmico para a comercialização e consumo,
porém a prevalência do mesmo deve ser monitorada com
cautela, pois estudos sugerem níveis crescentes de resis-
tência. Por outro lado, trabalho desenvolvido por Agnol
et al. (2013), foi encontrado percentualde 58,33% para
a presença do gene blaZ em Staphylococcus spp. isolados
de rebanho ovino diagnosticado com mastite. O estudo
de Olsen et al. (2006), afirmam que as espécies de Sta-
phylococcus presentes no mesmo microambiente podem
passar o gene blaZ uma a outra, se os fatores bacterianos
forem atendidos.
Ruegg et al. (2015), determinaram a susceptibi-
lidade antimicrobiana de S. aureus e Streptococcus spp.
de isolados de casos de mastite clinica e a presença de
genes de resistência antimicrobiano (blaZ, ermC, tetK e
tetM). Os autores relatam que a presença de genes de
resistência não foi proporcional a ocorrência de resis-
tência fenotípica, sugerindo uma seleção mais ampla
de genes deve ser testada e que mais pesquisas devem
ser realizadas para validar os pontos de interrupção da
resistência.
Vários genes estão associados á resistência aos
beta-lactâmicos que exige uma investigação minuciosa que
inclua a detecção de diferentes marcadores genéticos de
resistência, tal como o estudo da regulação da expressão
gênica do sistema mec, para investigar a compreensão do
real valor de sua detecção na predição da resistência aos
antimicrobianos beta-lactâmicos, conforme preconizado
pelo CLSI (Clinical and Laboratory Standards Institute)
(Mendonça et al.,2012). Souza et al. (2019), pressupõe
que a epidemiologia molecular, conhecimento aprimora-
do ligado a base genética da resistência aos antibióticos
beta-lactâmicos podem contribuir para afirmação de di-
retrizes para aprimorar práticas de manejo no tratamento
da mastite subclínica e no mapeamento da origem de
patógenos resistentes.
Conclusão
Com este estudo detectou-se a presença do gene
blaZ em 12,90% das cepas de S. aureus resistentes a
beta-lactâmicos, os gene mecA e mecA
LGA251
não foram
identificados nos isolados em estudo. Entretanto, a au-
sências destes não descarta a possibilidade da presença
de outros genes de resistência nas propriedades em es-
tudo. bem como a possibilidade de veiculação de clones
resistentes para humanos. Os resultados salientam a
necessidade do monitoramento, adoção de medidas de
controle que dificultem a disseminação desses genes e
o aumento de pesquisas no rastreamento dos possíveis
genes que possam estar relacionados ao mecanismo de
Borges, L. F. F. et al.
6
Cad. Ciênc. Agrá., v. 12, p. 01–07, https://doi.org/10.35699/2447-6218.2020.25185
resistência antimicrobiana, uma vez que esses podem ser
transferidos através de recombinação genética a outras
cepas e espécies.
Referências
Agnol; A. M. D.; Cavalcante, M. B.; França, C. A.; Costa Krewer, C.;
Queiros, A. A.; Costa, M. M.; Bragança, J. F. M.; Girardini, L. K. 2013.
Caracterização fenotípica e molecular de isolados de Staphylococcus
spp. obtidos de leite de ovelhas do Município de Chapecó-SC. Semina:
Ciências Agrárias, 34: 311-321. Disponível em: https://www.redalyc.
org/articulo.oa?id=445744119024.
Assis, G. B.; Pereira, F. L.; Zegarra, A. U.; Tavares, G. C.; Leal, C. A.;
Figueiredo, H. C. 2017. Use of MALDI-TOF mass spectrometry for
the fast identification of gram-positive fish pathogens. Frontiers in
microbiology, 8: 1492. Doi: https://doi.org/10.1111/jfd.12493.
Bagcigil, A. F.; Taponen, S.; Koort, J.; Bengtsson, B.; Myllyniemi, A.
L.; Pyörälä, S. 2012. Genetic basis of penicillin resistance of S. aureus
isolated in bovine mastitis. Acta Veterinaria Scandinavica; 54: 1-7. Doi:
https://doi.org/10.1186/1751-0147-54-69.
Bissong, M. E. A.; Ateba, C. N. 2020. Genotypic and Phenotypic Evaluation
of Biofilm Production and Antimicrobial Resistance in Staphylococcus
aureus Isolated from Milk, North West Province; South Africa. Antibiotics,
9: 156. Doi: https://doi.org/10.3390/antibiotics9040156.
Cerqueira; E. S.; Almeida; R. C. C. Staphylococcus aureus
resistente à meticilina (MRSA) em alimentos de origem animal:
uma revisão sistemática. 2013. Revista do Instituto Adolfo Lutz.
72: 268-281. Disponível em: https://pdfs.semanticscholar.
org/6474/0dd34639cf6c988128a785f47595a68b0182.pdf.
CLSI. Performance Standards for Antimicrobial Susceptibility Testing.
2018. 28th ed. CLSI supplement M100. Wayne, PA: Clinical and
Laboratory Standards Institute.
Dias, N. L.; Silva, D. C. B.; Oliveira, D. C. B. S.; Fonseca Júnior, A. A.;
Sales, M. L.; Silva, N. 2011. Detecção dos genes de Staphylococcus
aureus, enterotoxinas e de resistência à meticilina em leite. Arquivo
Brasileiro de Medicina Veterinária e Zootecnia, 63(6): 1547-1552. Doi:
https://doi.org/10.1590/S0102-09352011000600036.
Diaz; R.; Ramalheira. E.; Afreixo, V.; Gago, B. 2016. Methicillin-
resistant Staphylococcus aureus carrying the new mecC gene—a meta-
analysis. Diagnostic microbiology and infectious disease, 84: 135-140.
Doi: https://doi.org/10.1016/j.diagmicrobio.2015.10.014.
Diniz, C. M.; Melo, R. T. D.; Mendonça, E. P.; Coelho,L. R.; Fonseca,
B. B.; Rossi; D. A. 2010. Resistência a oxacilina em Staphylococcus spp
isolado de leite mastítico. Revista do Instituto Adolfo Lutz,69: 482-488.
Disponível em: http://www.ial.sp.gov.br/ial/revista/rev-inst-adolfo-
lutz.2010694.
García-Álvarez, L.; Holden, M. T.; Lindsay, H.; Webb, C. R.; Brown, D.
F.; Curran, M. D.; ... Parkhill, J. 2011. Meticillin-resistant Staphylococcus
aureus with a novel mecA homologue in human and bovine populations
in the UK and Denmark: a descriptive study. The Lancet infectious
diseases, 11: 595-603. Doi: https://doi.org/10.1016/S1473-
3099(11)70126-8.
Gu, J.; Li, H.; Li, M.; Vuong, C.; Otto, M.; Wen, Y.; Gao, Q. 2005. Sequência
de inserção bacteriana IS256 como potencial marcador molecular para
discriminar cepas invasivas de cepas comensais de Staphylococcus
epidermidis. Journal of Hospital Infecção, 61: 342-348. Doi: https://
doi.org/10.1016/j.jhin.2005.04.017.
International Working Group on the Classification of Staphylococcal
Cassette Chromosome Elements (IWG-SCC). 2009. Classification
of staphylococcal cassette chromosome mec (SCCmec): guidelines
for reporting novel SCCmec elements. Antimicrobial agents and
chemotherapy, 53: 4961-4967. Doi: 10.1128 / AAC.00579-09.
Mehndiratta, P. L.; Bhalla, P. 2014. Use of antibiotics in animal agriculture
& emergence of methicillin-resistant Staphylococcus aureus (MRSA)
clones: Need to assess the impact on public health. The Indian journal
of medical research, 140: 339. Disponível em: https://www.ncbi.nlm.
nih.gov/pmc/articles/PMC4248379/.
Melo, D. A. D.; Coelho, I. D. S.; Motta, C. C. D.; Rojas, A. C. C.
M.; Dubenczuk, F. C.; Coelho, S. D. M. D. O.; Souza, M. M. S. D.
2014. Impairments of mecA gene detection in bovine Staphylococcus
spp. Brazilian Journal of Microbiology, 45: 1075-1082. Doi: https://
doi.org/10.1590/S1517-83822014000300041.
Mendonça, E. C.; Marques, V. F.; Melo, D. A.; Alencar, T. A.; Coelho, I.
D. S.; Coelho, S. M.; Souza, M. 2012. Caracterização fenogenotípica da
resistência antimicrobiana em Staphylococcus spp. isolados de mastite
bovina. Pesquisa Veterinária Brasileira, 32: 859-864. Doi: https://doi.
org/10.1590/S0100-736X2012000900008.
Moritz, F.; Moritz, C. M. F. 2016. Resistência aos antimicrobianos em
Staphylococcus spp. associados à mastite bovina. Revista De Ciência
Veterinária E Saúde Pública, 3: 132-136. Doi: https://doi.org/10.4025/
revcivet.v3i2.34435.
Olsen, J. E.; Christensen, H.; Aarestrup, F. M. 2006. Diversity and
evolution of blaZ from Staphylococcus aureus and coagulase-negative
staphylococci. Journal of Antimicrobial Chemotherapy, 57: 450-460.
Doi: https://doi.org/10.1093/jac/dki492.
Pantosti; A. 2012. Methicillin-resistant Staphylococcus aureus
associated with animals and its relevance to human health. Frontiers in
microbiology; 3: 127. Doi: https://doi.org/10.3389/fmicb.2012.00127.
Paterson, G. K.; Harrison, E. M.; Holmes, M. A. 2014. The emergence
of mecC methicillin-resistant Staphylococcus aureus. Trends in
microbiology, 22: 42-47. Doi: 10.1016 / j.tim.2013.11.003.
Qu, Y.; Zhao, H.; Nobrega, D. B.; Cobo, E. R.; Han, B.; Zhao, Z.; Shumei,
L.; Mengyue, L.; Herman, W. B.; Gao, J. 2019. Molecular epidemiology
and distribution of antimicrobial resistance genes of Staphylococcus
species isolated from Chinese dairy cows with clinical mastitis. Journal of
dairy Science, 102: 1571-1583. Doi: https://doi.org/10.3168/jds.2018-
15136.
Rabelo, M. A.; Bezerra Neto, A. M.; Loibman, S. O.; da Costa Lima, J.
L.; Ferreira; E. L., Leal, N. C.; Maciel, M. A. V. 2014. The occurrence and
dissemination of methicillin and vancomycin-resistant Staphylococcus in
samples from patients and health professionals of a university hospital
in Recife, State of Pernambuco, Brazil. Revista da Sociedade Brasileira
de Medicina Tropical, 47: 437-446. Doi: https://doi.org/10.1590/0037-
8682-0071-2014.
Rahi, A.; Kazemeini, H.; Jafariaskari, S.; Seif, A.; Hosseini, S.; Dehkordi,
F. S. 2020. Avaliação genotípica e fenotípica da resistência a antibióticos e
perfil do cromossomo mec cassete estafilocócico no Staphylococcus aureus
resistente à meticilina recuperado do leite cru. Infecção e resistência a
medicamentos, 13: 273. Doi: https://doi.org/10.2147/IDR.S229499.
Caracterização genotípica de Staphylococcus aureus resistentes à meticilina isolados de tetos e leite bovino
7
Cad. Ciênc. Agrá., v. 12, p. 01–07, https://doi.org/10.35699/2447-6218.2020.25185
Ruegg, P. L.; Oliveira, L.; Jin ,W.; Okwumabua, O.; 2015 Phenotypic
antimicrobial susceptibility and occurrence of selected resistance genes
in gram-positive mastitis pathogens isolated from Wisconsin dairy cows.
Journal of dairy Science, 98:4521-34. Doi: https://doi.org/10.3168/
jds.2014-9137.
Sales, L. M.; Silva, T. M. Staphylococcus aureus meticilina resistente:
um desafio para a saúde pública. 2012. Acta Biomedica Brasiliensia,
3: 1-13. Disponível em: https://actabiomedica.com.br/index.php/
acta/article/view/31.
Schnitt, A.; Tenhagen, B. A. 2019. Risk Factors for the Occurrence
of Methicillin-Resistant Staphylococcus aureus in Dairy Herds:
An Update. Food borne pathogens and disease. Doi: https://doi.
org/10.1089/fpd.2019.2638.
Sheet, O. H.; Grabowski, N. T.; Klein, G.; Reich, F.; Abdulmawjood, A.
2019. Characterisation of mecA gene negative Staphylococcus aureus
isolated from bovine mastitis milk from Northern Germany. Folia
Microbiologica, 64: 845-855. Doi: 10.1007 / s12223-019-00698-z.
Silva, J. G.; Alcântara, A. M.; Mota, R. A. 2018. Mastite bovina
causada por Staphylococcus spp. resistentes à meticilina: revisão de
literatura. Pesquisa Veterinária Brasileira, 38: 223-228. Doi: https://
doi.org/10.1590/1678-5150-pvb-4996.
Silva, N. C. C.; Guimarães, F. F.; Manzi, M. P.; Budri, P. E.; Gómez-Sanz,
E.; Benito, D.; Langoni, H.; Rall, V. L. M.;Torres, C. 2013. Molecular
characterization and clonal diversity of methicillin-susceptible
Staphylococcus aureus in milk of cows with mastitis in Brazil. Journal
of dairy Science, 96: 6856-6862. Doi: https://doi.org/10.3168/jds.2013-
6719.
Siqueira, A. K.; Salerno, T.; Lara, G. H. B.; Condas, L. A. Z.; Pereira, V.
C.; Riboli, D. F. M.; Listoni, F. J. P.; Silva. A. V.; Leite, D. S.; Cunha, M. L.
R. S.; Ribeiro, M. G. 2017. Enterotoxin genes, multidrug resistance, and
molecular typing of Staphylococcus spp. isolated from organic bovine
milk. Brazilian Journal of Veterinary Research and Animal Science, 54:
81-87. Disponível em: https://doi.org/10.11606/issn.1678-4456.
bjvras.2017.109171.
Song, M.; He, Y.; Zhou, H.; Zhang, Y.; Li, X.; Yu, Y. 2016. Combined
analysis of DNA methylome and transcriptome reveal novel candidate
genes with susceptibility to bovine Staphylococcus aureus subclinical
mastitis. Scientific reports, 6: 1-15. Doi: https://doi.org/10.1038/
srep29390.
Souza; G. A. A D.; Almeida, A. C.; Souza Xavier, M. A.; Silva, L.
M. V.; Souza, C. N.; Sanglard, D. A. Oliveira Xavier, A. R. E. 2019.
Characterization and molecular epidemiology of Staphylococcus aureus
strains resistant to beta-lactams isolated from the milk of cows diagnosed
with subclinical mastitis. Veterinary World, 12:1931. Doi: 10.14202 /
vetworld.2019.1931-1939.
Xavier, A. R. E. O.; Almeida, A. C.; Souza, C. N.; Silva, L. M. V.;
Ruas, A. X. A.; Sanglard, D. A.; Júnior, A. F. M.; Oliveira, A. M. E.;
Xavier, M. A. S. 2017a. Phenotypic and genotypic characterization
of Staphylococcus aureus isolates in milk from flocks diagnosed with
subclinical mastitis. Genetics and Molecular Research, 16: 1-11. Doi:
http://dx.doi.org/10.4238/gmr16029709.
Xavier, A. R. E. O.; Lima, E. R.; Oliveira, A. M. E.; Cardoso, L.; Santos,
J.; Cangussu, C. H. C.; Santos, J. Cardoso, L.; Oliveira, A. M. E.; Lima,
E. R.; Xavier, M. A. S. 2017b. Genetic diversity of Bacillussp producers
of amylase isolated from the soil. Genetics and Molecular Research, 16.
Doi: 10.4238 / gmr16039771.